Review



superscript iv vilo master mix with ezdnase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher superscript iv vilo master mix with ezdnase
    Superscript Iv Vilo Master Mix With Ezdnase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iv+vilo+master+mix+ezdnase/superscript+iv+vilo+master+mix+with+ezdnase+enzyme/pmc12271399-284-9-16
    Average 90 stars, based on 1 article reviews
    superscript iv vilo master mix with ezdnase - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: Increased circulation time of Plasmodium falciparum underlies persistent asymptomatic infection in the dry season.
    Article Snippet: Cells were acquired using an LSR II and analyzed using FlowJo software 10.2 or higher versions. .. By RT–qPCR, RNA was extracted immediately after thawing RBC pellets using TRIzol LS (Ambion) according to manufacturer instructions, and complementary DNA (cDNA) was synthesized using SuperScript IV VILO Master Mix with ezDNase (Invitrogen). .. RT–qPCR was run on a qTower (Analytik Jena) using Power SYBR Green PCR Master Mix (Applied Biosystems) with primers for the P. falciparum reference gene glycine-tRNA ligase (PF14_ 0198) (forward, 5′-TGAGTGATATGGATAATA TAAAGGAACAAA-3′; reverse, 5′-GGATGATATTTCACAA ACGTATCTTTCT-3′) and for human GAPDH (forward, 5′-ACAACTTTGGTATCGTGGAAGG-3′; reverse, 5′-GCCATCACGCCA CAGTTTC-3′).

    Article Title: A basic charge cluster near the C-terminus of the cytoplasmic tail contributes to the molecular stability of human herpesvirus 8 E3 ubiquitin ligases.
    Article Snippet: Funding information Showa Pharmaceutical University; Japan Society for the Promotion of Science Abstract Human herpesvirus 8 (HHV8; also known as Kaposi's sarcoma‐associated herpesvirus [KSHV]) utilizes the viral E3 ubiquitin ligase family members K3 and K5 for immune evasion.. Both K3 and K5 mediate the ubiquitination of host MHC class I (MHC‐I) molecules, which play a key role in antigen presentation to cytotoxic T lymphocytes (CTLs).. Because ubiquitinated MHC‐I is immediately down‐regulated from the cell surface, HHV8‐infected cells can escape surveillance by CTLs.

    Transfection:

    Article Title: A basic charge cluster near the C-terminus of the cytoplasmic tail contributes to the molecular stability of human herpesvirus 8 E3 ubiquitin ligases.
    Article Snippet: Funding information Showa Pharmaceutical University; Japan Society for the Promotion of Science Abstract Human herpesvirus 8 (HHV8; also known as Kaposi's sarcoma‐associated herpesvirus [KSHV]) utilizes the viral E3 ubiquitin ligase family members K3 and K5 for immune evasion.. Both K3 and K5 mediate the ubiquitination of host MHC class I (MHC‐I) molecules, which play a key role in antigen presentation to cytotoxic T lymphocytes (CTLs).. Because ubiquitinated MHC‐I is immediately down‐regulated from the cell surface, HHV8‐infected cells can escape surveillance by CTLs.

    Purification:

    Article Title: A basic charge cluster near the C-terminus of the cytoplasmic tail contributes to the molecular stability of human herpesvirus 8 E3 ubiquitin ligases.
    Article Snippet: Funding information Showa Pharmaceutical University; Japan Society for the Promotion of Science Abstract Human herpesvirus 8 (HHV8; also known as Kaposi's sarcoma‐associated herpesvirus [KSHV]) utilizes the viral E3 ubiquitin ligase family members K3 and K5 for immune evasion.. Both K3 and K5 mediate the ubiquitination of host MHC class I (MHC‐I) molecules, which play a key role in antigen presentation to cytotoxic T lymphocytes (CTLs).. Because ubiquitinated MHC‐I is immediately down‐regulated from the cell surface, HHV8‐infected cells can escape surveillance by CTLs.

    Reverse Transcription:

    Article Title: A system to analyze the initiation of random X-chromosome inactivation using time-lapse imaging of single cells
    Article Snippet: The fixed cells were suspended in PB1 medium (Kyudo, Saga, Japan) and analyzed by flow cytometry on an SH800 instrument (Sony). .. Total RNA was extracted from cells using an RNeasy Micro Kit (Qiagen) and reverse transcribed with SuperScript IV VILO Master Mix with ezDNase (Thermo Fisher Scientific). .. The synthesized cDNA was amplified and detected using StepOne Plus (Thermo Fisher Scientific).

    Isolation:

    Article Title: Targeting the MR1-MAIT Cell Axis Improves Vaccine Efficacy and Affords Protection against Viral Pathogens
    Article Snippet: .. Total RNA was extracted using a PicoPure RNA Isolation Kit (Thermo Scientific) and converted to cDNA using SuperScript IV VILO Master Mix with ezDNase (Thermo Scientific). cDNA and TaqMan Fast Advanced Master Mix were added to each well of a custom-made, 96-well TaqMan Array Fast Plate (Thermo Scientific) containing lyophilized primer/probe sets listed in . cDNA was amplified per manufacturer’s instructions, and cycle threshold (Ct) values were generated using a StepOne Plus Real-Time PCR System (Applied Biosystems). ..

    Article Title: Differential response of human T-lymphocytes to arsenic and uranium
    Article Snippet: .. Total RNA was isolated using TRIzol (Invitrogen, CA, USA) per manufacturer instructions, and quantified using a Nanodrop ONE spectrophotometer (Thermo Fisher Scientific, MA, USA). cDNA was generated from 1 μg of RNA using the SuperScript IV VILO Master Mix with ezDNase (Thermo Fisher Scientific, MA, USA). .. The following SYBR Green PCR primers (Bio-Rad, CA, USA) were used to investigate gene expression changes: HMOX1 (F-TCCTGGCTCAGCCTCAAATG; R – CGTTAAACACCTCCCTCCCC), NQO1 (F – CGCAGACCTTGTGATATTCCAG; R – CGTTTCTTCCATCCTTCCAGG) and 18S (F – CGGAGGTTCGAAGACGATCAGATA; R – TTGGTTTCCCGGAAGCTGCC).

    Amplification:

    Article Title: Targeting the MR1-MAIT Cell Axis Improves Vaccine Efficacy and Affords Protection against Viral Pathogens
    Article Snippet: .. Total RNA was extracted using a PicoPure RNA Isolation Kit (Thermo Scientific) and converted to cDNA using SuperScript IV VILO Master Mix with ezDNase (Thermo Scientific). cDNA and TaqMan Fast Advanced Master Mix were added to each well of a custom-made, 96-well TaqMan Array Fast Plate (Thermo Scientific) containing lyophilized primer/probe sets listed in . cDNA was amplified per manufacturer’s instructions, and cycle threshold (Ct) values were generated using a StepOne Plus Real-Time PCR System (Applied Biosystems). ..

    Generated:

    Article Title: Targeting the MR1-MAIT Cell Axis Improves Vaccine Efficacy and Affords Protection against Viral Pathogens
    Article Snippet: .. Total RNA was extracted using a PicoPure RNA Isolation Kit (Thermo Scientific) and converted to cDNA using SuperScript IV VILO Master Mix with ezDNase (Thermo Scientific). cDNA and TaqMan Fast Advanced Master Mix were added to each well of a custom-made, 96-well TaqMan Array Fast Plate (Thermo Scientific) containing lyophilized primer/probe sets listed in . cDNA was amplified per manufacturer’s instructions, and cycle threshold (Ct) values were generated using a StepOne Plus Real-Time PCR System (Applied Biosystems). ..

    Article Title: Differential response of human T-lymphocytes to arsenic and uranium
    Article Snippet: .. Total RNA was isolated using TRIzol (Invitrogen, CA, USA) per manufacturer instructions, and quantified using a Nanodrop ONE spectrophotometer (Thermo Fisher Scientific, MA, USA). cDNA was generated from 1 μg of RNA using the SuperScript IV VILO Master Mix with ezDNase (Thermo Fisher Scientific, MA, USA). .. The following SYBR Green PCR primers (Bio-Rad, CA, USA) were used to investigate gene expression changes: HMOX1 (F-TCCTGGCTCAGCCTCAAATG; R – CGTTAAACACCTCCCTCCCC), NQO1 (F – CGCAGACCTTGTGATATTCCAG; R – CGTTTCTTCCATCCTTCCAGG) and 18S (F – CGGAGGTTCGAAGACGATCAGATA; R – TTGGTTTCCCGGAAGCTGCC).

    Real-time Polymerase Chain Reaction:

    Article Title: Targeting the MR1-MAIT Cell Axis Improves Vaccine Efficacy and Affords Protection against Viral Pathogens
    Article Snippet: .. Total RNA was extracted using a PicoPure RNA Isolation Kit (Thermo Scientific) and converted to cDNA using SuperScript IV VILO Master Mix with ezDNase (Thermo Scientific). cDNA and TaqMan Fast Advanced Master Mix were added to each well of a custom-made, 96-well TaqMan Array Fast Plate (Thermo Scientific) containing lyophilized primer/probe sets listed in . cDNA was amplified per manufacturer’s instructions, and cycle threshold (Ct) values were generated using a StepOne Plus Real-Time PCR System (Applied Biosystems). ..

    Control:

    Article Title: Epigenome-wide association study of peripheral immune cell populations in Parkinson’s disease
    Article Snippet: .. RNA was extracted from CD14 + monocytes using the RNeasy Mini Kit (Qiagen, Hilden, Germany), with adequate yield for 23 PD and 20 control samples, followed by cDNA synthesis using SuperScript IV VILO Master Mix with ezDNase (Invitrogen, Waltham, MA). .. Quantitative PCR (qPCR) was performed using TaqMan gene expression assays on a ViiA7 instrument (Applied Biosystems, Waltham, MA) with standard settings as recommended by the manufacturer.

    cDNA Synthesis:

    Article Title: Epigenome-wide association study of peripheral immune cell populations in Parkinson’s disease
    Article Snippet: .. RNA was extracted from CD14 + monocytes using the RNeasy Mini Kit (Qiagen, Hilden, Germany), with adequate yield for 23 PD and 20 control samples, followed by cDNA synthesis using SuperScript IV VILO Master Mix with ezDNase (Invitrogen, Waltham, MA). .. Quantitative PCR (qPCR) was performed using TaqMan gene expression assays on a ViiA7 instrument (Applied Biosystems, Waltham, MA) with standard settings as recommended by the manufacturer.

    Spectrophotometry:

    Article Title: Differential response of human T-lymphocytes to arsenic and uranium
    Article Snippet: .. Total RNA was isolated using TRIzol (Invitrogen, CA, USA) per manufacturer instructions, and quantified using a Nanodrop ONE spectrophotometer (Thermo Fisher Scientific, MA, USA). cDNA was generated from 1 μg of RNA using the SuperScript IV VILO Master Mix with ezDNase (Thermo Fisher Scientific, MA, USA). .. The following SYBR Green PCR primers (Bio-Rad, CA, USA) were used to investigate gene expression changes: HMOX1 (F-TCCTGGCTCAGCCTCAAATG; R – CGTTAAACACCTCCCTCCCC), NQO1 (F – CGCAGACCTTGTGATATTCCAG; R – CGTTTCTTCCATCCTTCCAGG) and 18S (F – CGGAGGTTCGAAGACGATCAGATA; R – TTGGTTTCCCGGAAGCTGCC).



    Similar Products

    90
    Thermo Fisher superscript iv vilo master mix with ezdnase
    Superscript Iv Vilo Master Mix With Ezdnase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iv+vilo+master+mix+ezdnase/superscript+iv+vilo+master+mix+with+ezdnase+enzyme/pmc12271399-284-9-16
    Average 90 stars, based on 1 article reviews
    superscript iv vilo master mix with ezdnase - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript iv vilo master mix with ezdnase enzyme
    Superscript Iv Vilo Master Mix With Ezdnase Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iv+vilo+master+mix+ezdnase/superscript+iv+vilo+master+mix+with+ezdnase+enzyme/pm40646332-107-39-43
    Average 90 stars, based on 1 article reviews
    superscript iv vilo master mix with ezdnase enzyme - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript tm iv vilo tm master mix with ezdnase tm enzyme
    Superscript Tm Iv Vilo Tm Master Mix With Ezdnase Tm Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/superscript+iv+vilo+master+mix+ezdnase/superscript+iv+vilo+master+mix+with+ezdnase+enzyme/pm40628264-433-161-164
    Average 90 stars, based on 1 article reviews
    superscript tm iv vilo tm master mix with ezdnase tm enzyme - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results